pCMV-αIFNα-ab
(Plasmid
#110799)
-
PurposeExpression and secretion of an scFv antibody (clone) 4EA1 against all mouse interferon α subtypes in mammalian cells
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA/myc/ER
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4817
- Total vector size (bp) 5066
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameantibody against mouse interferon alpha
-
Alt nameαIFNα-ib
-
Alt namescFv derived from 4E-A1 monoclonal rat antibody
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)942
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc epitope tag (C terminal on insert)
- His6 tag (C terminal on insert)
- ER signal peptide (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-αIFNα-ab was a gift from Thomas Böldicke (Addgene plasmid # 110799 ; http://n2t.net/addgene:110799 ; RRID:Addgene_110799) -
For your References section:
ER intrabody-mediated inhibition of interferon alpha secretion by mouse macrophages and dendritic cells. Bussow K, Themann P, Luu S, Pentrowski P, Harting C, Majewski M, Vollmer V, Koster M, Grashoff M, Zawatzky R, Van den Heuvel J, Kroger A, Boldicke T. PLoS One. 2019 Apr 16;14(4):e0215062. doi: 10.1371/journal.pone.0215062. eCollection 2019. 10.1371/journal.pone.0215062 PubMed 30990863