pET22b-ecDHFR-Y100F
(Plasmid
#110826)
-
PurposeBacterial expression of E.coli DHFR Y100F mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5493
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameecDHFR
-
Alt namedihydrofolate reductase
-
Alt namefolA
-
SpeciesE.coli
-
Insert Size (bp)480
-
MutationY100 mutated to F100
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-ecDHFR-Y100F was a gift from Stephen Benkovic (Addgene plasmid # 110826 ; http://n2t.net/addgene:110826 ; RRID:Addgene_110826) -
For your References section:
Escherichia coli dihydrofolate reductase catalyzed proton and hydride transfers: temporal order and the roles of Asp27 and Tyr100. Liu CT, Francis K, Layfield JP, Huang X, Hammes-Schiffer S, Kohen A, Benkovic SJ. Proc Natl Acad Sci U S A. 2014 Dec 23;111(51):18231-6. doi: 10.1073/pnas.1415940111. Epub 2014 Dec 1. 10.1073/pnas.1415940111 PubMed 25453098