pET27b-ecDHFR-N23PP/S148A
(Plasmid
#110829)
-
PurposeBacterial expression of E.coli DHFR N23PP/S148A mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET27b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5414
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameecDHFR
-
Alt namedihydrofolate reductase
-
Alt namefolA
-
SpeciesE.coli
-
Insert Size (bp)483
-
MutationN23 mutated to P23; a proline residue inserted between residues 23 and 24 of wild-type ecDHFR; S148 mutated to A148
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET27b-ecDHFR-N23PP/S148A was a gift from Stephen Benkovic (Addgene plasmid # 110829 ; http://n2t.net/addgene:110829 ; RRID:Addgene_110829) -
For your References section:
A dynamic knockout reveals that conformational fluctuations influence the chemical step of enzyme catalysis. Bhabha G, Lee J, Ekiert DC, Gam J, Wilson IA, Dyson HJ, Benkovic SJ, Wright PE. Science. 2011 Apr 8;332(6026):234-8. doi: 10.1126/science.1198542. 10.1126/science.1198542 PubMed 21474759