pmTurquoise-parkin
(Plasmid
#110945)
-
PurposeExpresses the ubiquitin ligase parkin fused to mTurquoise
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepECFP-C1
- Backbone size w/o insert (bp) 4698
- Total vector size (bp) 6096
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE3 ubiquitin ligase parkin
-
Alt nameparkin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2009
-
Entrez GenePRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
- Promoter CMV
-
Tag
/ Fusion Protein
- mTurquoise2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CAGCCATACCACATTTGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was assembled using fragments from plasmids #47560 (backbone) and #36204 (mTurquoise2 insert).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmTurquoise-parkin was a gift from Pablo Rivera-Fuentes (Addgene plasmid # 110945 ; http://n2t.net/addgene:110945 ; RRID:Addgene_110945) -
For your References section:
Disruption of mitochondrial redox homeostasis by enzymatic activation of a trialkylphosphine probe. Nguyen J, Tirla A, Rivera-Fuentes P. Org Biomol Chem. 2021 Mar 28;19(12):2681-2687. doi: 10.1039/d0ob02259d. Epub 2021 Feb 26. 10.1039/d0ob02259d PubMed 33634293