Skip to main content

pmTurquoise-parkin
(Plasmid #110945)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110945 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pECFP-C1
  • Backbone size w/o insert (bp) 4698
  • Total vector size (bp) 6096
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E3 ubiquitin ligase parkin
  • Alt name
    parkin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2009
  • Entrez Gene
    PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
  • Promoter CMV
  • Tag / Fusion Protein
    • mTurquoise2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGAAGCGCGATCACATGG
  • 3′ sequencing primer CAGCCATACCACATTTGTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was assembled using fragments from plasmids #47560 (backbone) and #36204 (mTurquoise2 insert).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmTurquoise-parkin was a gift from Pablo Rivera-Fuentes (Addgene plasmid # 110945 ; http://n2t.net/addgene:110945 ; RRID:Addgene_110945)
  • For your References section:

    Disruption of mitochondrial redox homeostasis by enzymatic activation of a trialkylphosphine probe. Nguyen J, Tirla A, Rivera-Fuentes P. Org Biomol Chem. 2021 Mar 28;19(12):2681-2687. doi: 10.1039/d0ob02259d. Epub 2021 Feb 26. 10.1039/d0ob02259d PubMed 33634293