AByF
(Plasmid
#111084)
-
PurposeIntegrates marker gene onto D. melanogaster Y chromosome
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggybac
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 8687
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameY homology arm left
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)999
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaagcttcatgggatctgctg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegypsy insulator
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)432
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTAATAAGTGTGCGTTGAATTTATT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert name3xP3 promoter
-
SpeciesSynthetic
-
Insert Size (bp)264
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer AATTCGAGCTCGCCCGGG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Insert Size (bp)1432
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer atggtgagcaagggcgaggag
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameSV40 3'UTR
-
SpeciesSynthetic
-
Insert Size (bp)248
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGCGACTCTAGATCATAA
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameCTCF insulator
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)308
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer ccttgcagcgccacctgg
- (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameY homology arm right
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)964
Cloning Information for Gene/Insert 7
- Cloning method Gibson Cloning
- 5′ sequencing primer TACAATTTGATTCAACGGTAGTGTTTTGT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AByF was a gift from Omar Akbari (Addgene plasmid # 111084 ; http://n2t.net/addgene:111084 ; RRID:Addgene_111084) -
For your References section:
Site-specific transgenesis of the D. melanogaster Y-chromosome using CRISPR/Cas9. Buchman A, Akbari OS. Insect Mol Biol. 2018 Aug 6. doi: 10.1111/imb.12528. 10.1111/imb.12528 PubMed 30079589