piHGpd/G170D
(Plasmid
#1113)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 1113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS303
-
Backbone manufacturerATCC (#77189)
- Backbone size w/o insert (bp) 4453
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSP82
-
Alt nameHsp90
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3800
-
MutationHSP82 with glycine 170 changed to aspartic acid; regulated by the strong constitutive promoter GPD
-
GenBank IDK01387
-
Entrez GeneHSP82 (a.k.a. YPL240C, HSP90)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GPDpro-F (CGGTAGGTATTGATTGTAATTCTG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piHGpd/G170D was a gift from Susan Lindquist (Addgene plasmid # 1113 ; http://n2t.net/addgene:1113 ; RRID:Addgene_1113) -
For your References section:
Identification of SSF1, CNS1, and HCH1 as multicopy suppressors of a Saccharomyces cerevisiae Hsp90 loss-of-function mutation. Nathan DF, Vos MH, Lindquist S. Proc Natl Acad Sci U S A 1999 Feb 16;96(4):1409-14. 10.1073/pnas.96.4.1409 PubMed 9990037