Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

piHGpd/G170D
(Plasmid #1113)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 1113 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS303
  • Backbone manufacturer
    ATCC (#77189)
  • Backbone size w/o insert (bp) 4453
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSP82
  • Alt name
    Hsp90
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    3800
  • Mutation
    HSP82 with glycine 170 changed to aspartic acid; regulated by the strong constitutive promoter GPD
  • GenBank ID
    K01387
  • Entrez Gene
    HSP82 (a.k.a. YPL240C, HSP90)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GPDpro-F (CGGTAGGTATTGATTGTAATTCTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piHGpd/G170D was a gift from Susan Lindquist (Addgene plasmid # 1113 ; http://n2t.net/addgene:1113 ; RRID:Addgene_1113)
  • For your References section:

    Identification of SSF1, CNS1, and HCH1 as multicopy suppressors of a Saccharomyces cerevisiae Hsp90 loss-of-function mutation. Nathan DF, Vos MH, Lindquist S. Proc Natl Acad Sci U S A 1999 Feb 16;96(4):1409-14. 10.1073/pnas.96.4.1409 PubMed 9990037