pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL
(Plasmid
#111389)
-
PurposeAAV vector with hSynapsin promoter, Cre-ON ChETA-mRuby2 (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4116
- Total vector size (bp) 5769
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChETA-mRuby2
-
Alt namehChR2(E123T/H134R)-mRuby2
-
SpeciesSynthetic
-
Insert Size (bp)1653
-
GenBank ID
- Promoter hSynapsin
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CCAAATTGCGCATCCCCTATC
- 3′ sequencing primer GCAGCGTATCCACATAGCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameW3SL
-
SpeciesSynthetic
-
Insert Size (bp)427
-
MutationW3SL is built from a shortened WPRE, an upstream element and SV40 late polyadenylation signal (Choi et al., 2014). This W3SL cassette allows 0.7 kb additional cloning capacity and shows comparable expression efficiency with conventional WPRE-polyA cassettes.
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PciI (not destroyed)
- 5′ sequencing primer tgttgctccttttacgctatg
- 3′ sequencing primer CCAGTTTGGAACAAGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL was a gift from Adam Kepecs (Addgene plasmid # 111389 ; http://n2t.net/addgene:111389 ; RRID:Addgene_111389) -
For your References section:
A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392