Skip to main content

pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL
(Plasmid #111389)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111389 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4116
  • Total vector size (bp) 5769
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ChETA-mRuby2
  • Alt name
    hChR2(E123T/H134R)-mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    1653
  • GenBank ID
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CCAAATTGCGCATCCCCTATC
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    W3SL
  • Species
    Synthetic
  • Insert Size (bp)
    427
  • Mutation
    W3SL is built from a shortened WPRE, an upstream element and SV40 late polyadenylation signal (Choi et al., 2014). This W3SL cassette allows 0.7 kb additional cloning capacity and shows comparable expression efficiency with conventional WPRE-polyA cassettes.

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PciI (not destroyed)
  • 5′ sequencing primer tgttgctccttttacgctatg
  • 3′ sequencing primer CCAGTTTGGAACAAGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL was a gift from Adam Kepecs (Addgene plasmid # 111389 ; http://n2t.net/addgene:111389 ; RRID:Addgene_111389)
  • For your References section:

    A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392