pCS6-ZF(VEGFA)-StaPL(TI)-tdRFP-KRAB
(Plasmid #111504)

• Purpose: Expresses a zinc finger specific to the human VEGFA locus, which is linked to a KRAB transcriptional repression domain via a StaPL(TI) module, in mammalian cells. [TI = telaprevir inhibited].
• Depositing Lab: Michael Lin
• Publication: Jacobs et al Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2.

Backbone

• Vector backbone: pCMV-SPORT6
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 7276
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ZF(VEGFA)-StaPL(TI)-tdRFP-KRAB
• Species: H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a, Discosoma sp.
• Insert Size (bp): 2910
• Mutation: The HCV NS3 protease carries F43L, Q80K, S122R, and D168Y mutations.
• GenBank ID: NC_004102
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACAGCTATGACCATTAGGCCT
• 3′ sequencing primer: GTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pCS6-ZF(VEGFA)-StaPL(TI)-tdRFP-KRAB.gb
• A portion of this plasmid was derived from a plasmid made by: the Roger Tsien lab [tdTomato RFP, Ref. 1].

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

[Ref. 1]
SHANER N.C., CAMPBELL R.E., STEINBACH P.A., GIEPMANS B.N., PALMER A.E. & TSIEN R.Y. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22: 1567-1572.