plexm-mouse LRRC33
(Plasmid
#111601)
-
PurposeExpress mouse LRRC33 in 293T cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplexm
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
-
Selectable markersN/A
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse LRRC33
-
Alt nameNRROS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
MutationStarts at aa 18
-
Entrez GeneNrros (a.k.a. E430025L02Rik, Lrcc33, Lrrc33)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (destroyed during cloning)
- 3′ cloning site Sal I (destroyed during cloning)
- 5′ sequencing primer ATGGAGTTCCCGCCCCTCTGGC
- 3′ sequencing primer TCAGTATATGGAGGACCAGTGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plexm-mouse LRRC33 was a gift from Timothy Springer (Addgene plasmid # 111601 ; http://n2t.net/addgene:111601 ; RRID:Addgene_111601) -
For your References section:
A Milieu Molecule for TGF-beta Required for Microglia Function in the Nervous System. Qin Y, Garrison BS, Ma W, Wang R, Jiang A, Li J, Mistry M, Bronson RT, Santoro D, Franco C, Robinton DA, Stevens B, Rossi DJ, Lu C, Springer TA. Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14. 10.1016/j.cell.2018.05.027 PubMed 29909984