Skip to main content

33-G-X5-pEF1/V5-His
(Plasmid #111605)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111605 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEF1/V5-His
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human LRRC33 and GARP chimeria
  • Alt name
    NRROS and GARP chimeria
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Entrez Gene
    NRROS (a.k.a. ELLP3030, GARPL1, LRRC33, UNQ3030)
  • Promoter EF1a
  • Tag / Fusion Protein
    • Flag tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer ggatccgctagcgccaccatgtggtg
  • 3′ sequencing primer ctagagcggccgctttaGGCTTTAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    33-G-X5-pEF1/V5-His was a gift from Timothy Springer (Addgene plasmid # 111605 ; http://n2t.net/addgene:111605 ; RRID:Addgene_111605)
  • For your References section:

    A Milieu Molecule for TGF-beta Required for Microglia Function in the Nervous System. Qin Y, Garrison BS, Ma W, Wang R, Jiang A, Li J, Mistry M, Bronson RT, Santoro D, Franco C, Robinton DA, Stevens B, Rossi DJ, Lu C, Springer TA. Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14. 10.1016/j.cell.2018.05.027 PubMed 29909984