33-G-X5-pEF1/V5-His
(Plasmid
#111605)
-
PurposeExpress human 33-G-X5 in 293T cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF1/V5-His
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman LRRC33 and GARP chimeria
-
Alt nameNRROS and GARP chimeria
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
Entrez GeneNRROS (a.k.a. ELLP3030, GARPL1, LRRC33, UNQ3030)
- Promoter EF1a
-
Tag
/ Fusion Protein
- Flag tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Nhe I (not destroyed)
- 5′ sequencing primer ggatccgctagcgccaccatgtggtg
- 3′ sequencing primer ctagagcggccgctttaGGCTTTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
33-G-X5-pEF1/V5-His was a gift from Timothy Springer (Addgene plasmid # 111605 ; http://n2t.net/addgene:111605 ; RRID:Addgene_111605) -
For your References section:
A Milieu Molecule for TGF-beta Required for Microglia Function in the Nervous System. Qin Y, Garrison BS, Ma W, Wang R, Jiang A, Li J, Mistry M, Bronson RT, Santoro D, Franco C, Robinton DA, Stevens B, Rossi DJ, Lu C, Springer TA. Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14. 10.1016/j.cell.2018.05.027 PubMed 29909984