Skip to main content

pmCherry-EXO1a
(Plasmid #111629)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111629 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-N1
  • Modifications to backbone
    eGFP of peGFP-N1 plasmid was substituted with mCherry
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exonuclease 1a
  • Alt name
    EXO1a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2409
  • Entrez Gene
    EXO1 (a.k.a. HEX1, hExoI)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ACCAGAGTCGGGTACTGTTTCAGA
  • 3′ sequencing primer TAGTGTTCCCAAAGTGGGTGGTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-EXO1a was a gift from Marco Muzi-Falconi (Addgene plasmid # 111629 ; http://n2t.net/addgene:111629 ; RRID:Addgene_111629)
  • For your References section:

    Human exonuclease 1 connects nucleotide excision repair (NER) processing with checkpoint activation in response to UV irradiation. Sertic S, Pizzi S, Cloney R, Lehmann AR, Marini F, Plevani P, Muzi-Falconi M. Proc Natl Acad Sci U S A. 2011 Aug 16;108(33):13647-52. doi: 10.1073/pnas.1108547108. Epub 2011 Aug 1. 10.1073/pnas.1108547108 PubMed 21808022