-
PurposeExpresses human WT Exonuclease 1a (EXO1a) tagged with mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmCherry-N1
-
Modifications to backboneeGFP of peGFP-N1 plasmid was substituted with mCherry
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExonuclease 1a
-
Alt nameEXO1a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2409
-
Entrez GeneEXO1 (a.k.a. HEX1, hExoI)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ACCAGAGTCGGGTACTGTTTCAGA
- 3′ sequencing primer TAGTGTTCCCAAAGTGGGTGGTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-EXO1a was a gift from Marco Muzi-Falconi (Addgene plasmid # 111629 ; http://n2t.net/addgene:111629 ; RRID:Addgene_111629) -
For your References section:
Human exonuclease 1 connects nucleotide excision repair (NER) processing with checkpoint activation in response to UV irradiation. Sertic S, Pizzi S, Cloney R, Lehmann AR, Marini F, Plevani P, Muzi-Falconi M. Proc Natl Acad Sci U S A. 2011 Aug 16;108(33):13647-52. doi: 10.1073/pnas.1108547108. Epub 2011 Aug 1. 10.1073/pnas.1108547108 PubMed 21808022