ACS_4
(Plasmid
#111646)
-
PurposeFunclib design ACS_4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 5367
- Total vector size (bp) 7323
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACS_4
-
Alt nameFunclib design ACS_4
-
SpeciesSynthetic
-
Insert Size (bp)1956
-
Mutationsee depositor comments below
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGGGAATTG
- 3′ sequencing primer CTAGCATAACCCCTTGGGGCCTCTAAACGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there is a mixed population for residue 383 present in this stock (L383 and V383). The depositing lab has noted that this residue does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACS_4 was a gift from Sarel Fleishman (Addgene plasmid # 111646 ; http://n2t.net/addgene:111646 ; RRID:Addgene_111646) -
For your References section:
Automated Design of Efficient and Functionally Diverse Enzyme Repertoires. Khersonsky O, Lipsh R, Avizemer Z, Ashani Y, Goldsmith M, Leader H, Dym O, Rogotner S, Trudeau DL, Prilusky J, Amengual-Rigo P, Guallar V, Tawfik DS, Fleishman SJ. Mol Cell. 2018 Oct 4;72(1):178-186.e5. doi: 10.1016/j.molcel.2018.08.033. Epub 2018 Sep 27. 10.1016/j.molcel.2018.08.033 PubMed 30270109