OeNL(Ca2+)_18μ-pcDNA3
(Plasmid
#111928)
-
PurposeOrange color bright luminescent calcium indicator with intermediate affinity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7107
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOeNL(Ca2+)_18μ
-
SpeciesSynthetic
-
Insert Size (bp)1707
-
MutationE67D, E104D, D133E at CaM
-
GenBank IDLC334055
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTGGATCCGATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer ATGCTCGAGTTACGCCAGAATGCGTTCGCACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OeNL(Ca2+)_18μ-pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 111928 ; http://n2t.net/addgene:111928 ; RRID:Addgene_111928) -
For your References section:
Bioluminescent Low-Affinity Ca(2+) Indicator for ER with Multicolor Calcium Imaging in Single Living Cells. Hossain MN, Suzuki K, Iwano M, Matsuda T, Nagai T. ACS Chem Biol. 2018 Mar 9. doi: 10.1021/acschembio.7b01014. 10.1021/acschembio.7b01014 PubMed 29494125