pJB03
(Plasmid
#111961)
-
PurposeExpresses MBP-GFP-DHFR; construct generated for pull-down and localization experiments
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMal
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6700
- Total vector size (bp) 7926
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemEGFP
-
Alt nameGFP
-
Insert Size (bp)717
-
Mutationenhanced GFP with monomerizing A206K mutation
- Promoter Tac
-
Tag
/ Fusion Protein
- DHFR (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGGTGGTGCCCATCCTGG
- 3′ sequencing primer CTTGTACAGCTCGTCCATGCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeDHFR
-
Alt nameDehydrofolate reductase; DHFR
-
SpeciesE. Coli
-
Insert Size (bp)474
-
MutationeDHFR;residues 2-159
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATCAGTCTGATTGCGGCG
- 3′ sequencing primer CCGCCGCTCCAGAATCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB03 was a gift from Matthew Good (Addgene plasmid # 111961 ; http://n2t.net/addgene:111961 ; RRID:Addgene_111961) -
For your References section:
Optochemical Control of Protein Localization and Activity within Cell-like Compartments. Caldwell RM, Bermudez JG, Thai D, Aonbangkhen C, Schuster BS, Courtney T, Deiters A, Hammer DA, Chenoweth DM, Good MC. Biochemistry. 2018 May 8;57(18):2590-2596. doi: 10.1021/acs.biochem.8b00131. Epub 2018 Apr 19. 10.1021/acs.biochem.8b00131 PubMed 29671583