NYESO alpha into TRAC HDRT Source (pTR 223)
(Plasmid
#112023)
-
PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alpha
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNYESO alpha into TRAC HDRT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1098
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NYESO alpha into TRAC HDRT Source (pTR 223) was a gift from Alexander Marson (Addgene plasmid # 112023 ; http://n2t.net/addgene:112023 ; RRID:Addgene_112023) -
For your References section:
Reprogramming human T cell function and specificity with non-viral genome targeting. Roth TL, Puig-Saus C, Yu R, Shifrut E, Carnevale J, Li PJ, Hiatt J, Saco J, Krystofinski P, Li H, Tobin V, Nguyen DN, Lee MR, Putnam AL, Ferris AL, Chen JW, Schickel JN, Pellerin L, Carmody D, Alkorta-Aranburu G, Del Gaudio D, Matsumoto H, Morell M, Mao Y, Cho M, Quadros RM, Gurumurthy CB, Smith B, Haugwitz M, Hughes SH, Weissman JS, Schumann K, Esensten JH, May AP, Ashworth A, Kupfer GM, Greeley SAW, Bacchetta R, Meffre E, Roncarolo MG, Romberg N, Herold KC, Ribas A, Leonetti MD, Marson A. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0326-5. doi: 10.1038/s41586-018-0326-5. 10.1038/s41586-018-0326-5 PubMed 29995861