pJW1664
(Plasmid
#112038)
-
PurposeCEN/ARS plasmid expression of mitochondrial Su9-TagBFP marked with HIS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS313
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSu9
-
SpeciesS. cerevisiae (budding yeast)
-
Mutationamino acids 1-76
-
Tag
/ Fusion Protein
- TagBFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGTTCCCTGAAATTATTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1664 was a gift from Jonathan Weissman (Addgene plasmid # 112038 ; http://n2t.net/addgene:112038 ; RRID:Addgene_112038) -
For your References section:
Defining the physiological role of SRP in protein-targeting efficiency and specificity. Costa EA, Subramanian K, Nunnari J, Weissman JS. Science. 2018 Jan 18. pii: science.aar3607. doi: 10.1126/science.aar3607. 10.1126/science.aar3607 PubMed 29348368