pJW1672
(Plasmid
#112046)
-
PurposeCEN/ARS plasmid for GAL-inducible PST1-V5-TEV-EGFP expression marked with URA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS316
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePST1
-
SpeciesS. cerevisiae (budding yeast)
- Promoter GAL1
-
Tag
/ Fusion Protein
- V5-TEV-EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTATTACTTCTTATTCAAATGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene NGS results identified an ambiguous base (A/C) at position 2762, in yEGFP. Ura marker present. This could result in a G67C mutation in yEGFP, though this is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1672 was a gift from Jonathan Weissman (Addgene plasmid # 112046 ; http://n2t.net/addgene:112046 ; RRID:Addgene_112046) -
For your References section:
Defining the physiological role of SRP in protein-targeting efficiency and specificity. Costa EA, Subramanian K, Nunnari J, Weissman JS. Science. 2018 Jan 18. pii: science.aar3607. doi: 10.1126/science.aar3607. 10.1126/science.aar3607 PubMed 29348368