-
PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
- Total vector size (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDsRed2
-
SpeciesSynthetic
-
Insert Size (bp)678
-
MutationDsRed2 contains a silent nucleotide substitution G417A in order to eliminate the intrinsic BbsI site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTGCCGCCTTCAAGTACTT
- 3′ sequencing primer GGAAAGGACAGTGGGAGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-DsRed2 was a gift from Yinming Liang (Addgene plasmid # 112219 ; http://n2t.net/addgene:112219 ; RRID:Addgene_112219) -
For your References section:
Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion. Luo J, Lu L, Gu Y, Huang R, Gui L, Li S, Qi X, Zheng W, Chao T, Zheng Q, Liang Y, Zhang L. J Biotechnol. 2018 Jun 7;281:11-20. doi: 10.1016/j.jbiotec.2018.06.308. 10.1016/j.jbiotec.2018.06.308 PubMed 29886029