pET-MBP-CreM_E352A
(Plasmid
#112239)
-
PurposepET28-derived plasmid that expresses an N-terminal maltose binding fusion construct of CreM with E352A mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28-derived
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCreM_E352A
-
MutationGlutamate 352 (E352) mutated to an alanine.
-
GenBank IDALA99210.1
-
Tag
/ Fusion Protein
- MBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-MBP-CreM_E352A was a gift from Emily Balskus (Addgene plasmid # 112239 ; http://n2t.net/addgene:112239 ; RRID:Addgene_112239) -
For your References section:
Discovery of a Diazo-Forming Enzyme in Cremeomycin Biosynthesis. Waldman AJ, Balskus EP. J Org Chem. 2018 May 29. doi: 10.1021/acs.joc.8b00367. 10.1021/acs.joc.8b00367 PubMed 29771512
