Skip to main content

pET28c_S(-31)-M30_dT7term
(Plasmid #112253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112253 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28c
  • Backbone size w/o insert (bp) 5126
  • Total vector size (bp) 5574
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S(-31)-M30 apta-FRET RNA origami with T7 promoter and terminators.
  • Species
    Synthetic
  • Insert Size (bp)
    448
  • Promoter T7 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gctctcccttatgcgactcc
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pET28c-F30–2xdBroccoli was received as a gift from Samie Jaffrey (Addgene plasmid # 66843).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28c_S(-31)-M30_dT7term was a gift from Ebbe Sloth Andersen (Addgene plasmid # 112253 ; http://n2t.net/addgene:112253 ; RRID:Addgene_112253)
  • For your References section:

    Development of a genetically encodable FRET system using fluorescent RNA aptamers. Jepsen MDE, Sparvath SM, Nielsen TB, Langvad AH, Grossi G, Gothelf KV, Andersen ES. Nat Commun. 2018 Jan 2;9(1):18. doi: 10.1038/s41467-017-02435-x. 10.1038/s41467-017-02435-x PubMed 29295996