pET28c_S*5-M5_dT7term
(Plasmid
#112254)
-
PurposeExpresses the S*5-M5 apta-FRET RNA origami structure.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28c
- Backbone size w/o insert (bp) 5126
- Total vector size (bp) 5506
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS*5-M5 apta-FRET RNA origami with T7 promoter and terminators.
-
SpeciesSynthetic
-
Insert Size (bp)380
- Promoter T7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gctctcccttatgcgactcc
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pET28c-F30–2xdBroccoli was received as a gift from Samie Jaffrey (Addgene plasmid # 66843).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28c_S*5-M5_dT7term was a gift from Ebbe Sloth Andersen (Addgene plasmid # 112254 ; http://n2t.net/addgene:112254 ; RRID:Addgene_112254) -
For your References section:
Development of a genetically encodable FRET system using fluorescent RNA aptamers. Jepsen MDE, Sparvath SM, Nielsen TB, Langvad AH, Grossi G, Gothelf KV, Andersen ES. Nat Commun. 2018 Jan 2;9(1):18. doi: 10.1038/s41467-017-02435-x. 10.1038/s41467-017-02435-x PubMed 29295996