pLJM1-NtermRGS2-GFP-CIBN
              
              
                (Plasmid
                
                #112258)
              
            
            
            
          - 
            PurposeExpresses alpha-helix component of opto-RGS2 in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLJM1
- Backbone size w/o insert (bp) 7389
- Total vector size (bp) 8857
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameNtermRGS2-GFP-CIBN
- 
                    SpeciesH. sapiens (human), A. thaliana (mustard weed)
- 
                  Insert Size (bp)1530
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - GFP
 
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLJM1-NtermRGS2-GFP-CIBN was a gift from Brian Chow (Addgene plasmid # 112258 ; http://n2t.net/addgene:112258 ; RRID:Addgene_112258)
- 
                For your References section: Optogenetic Inhibition of Galphaq Protein Signaling Reduces Calcium Oscillation Stochasticity. Hannanta-Anan P, Chow BY. ACS Synth Biol. 2018 Jun 15;7(6):1488-1495. doi: 10.1021/acssynbio.8b00065. Epub 2018 Jun 4. 10.1021/acssynbio.8b00065 PubMed 29792810
 
    
 
    
 
                         
             
            