pU6-EF-gAAVS1
(Plasmid
#112262)
-
PurposeExpress g-AAVS1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 3338
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameg-AAVS1
-
gRNA/shRNA sequencegtcaccaatcctgtccctag
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-EF-gAAVS1 was a gift from Zhili Rong (Addgene plasmid # 112262 ; http://n2t.net/addgene:112262 ; RRID:Addgene_112262) -
For your References section:
iKA-CRISPR hESCs for inducible and multiplex orthogonal gene knockout and activation. Ma S, Lv J, Sun J, Tang P, Li H, Zhou H, Zhang Z, Lin Y, Rong Z. FEBS Lett. 2018 Jun 5. doi: 10.1002/1873-3468.13127. 10.1002/1873-3468.13127 PubMed 29869798