This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQE80L TriCatcher-ELP
(Plasmid #112630)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112630 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE80L
  • Backbone manufacturer
    Qiagen Inc.
  • Backbone size w/o insert (bp) 4714
  • Total vector size (bp) 6550
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TriCatcher-ELP
  • Species
    Synthetic
  • Insert Size (bp)
    1836
  • Promoter T5
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • TEV cleavage site (N terminal on insert)
    • TEV cleavage site

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATAAAAAATTTATTTGCTTTGTGAGCGG
  • 3′ sequencing primer CGAGCGTTCTGAACAAATCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE80L TriCatcher-ELP was a gift from Mark Howarth (Addgene plasmid # 112630 ; http://n2t.net/addgene:112630 ; RRID:Addgene_112630)
  • For your References section:

    Assembling and decorating hyaluronan hydrogels with twin protein superglues to mimic cell-cell interactions. Wieduwild R, Howarth M. Biomaterials /10.1016/j.biomaterials.2018.07.020