Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQE80L TriCatcher-MMP
(Plasmid #112632)


Item Catalog # Description Quantity Price (USD)
Plasmid 112632 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Qiagen Inc.
  • Backbone size w/o insert (bp) 4714
  • Total vector size (bp) 6556
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    central matrix metalloproteinase-cleavable sequence
  • Promoter T5
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 3′ sequencing primer CGAGCGTTCTGAACAAATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE80L TriCatcher-MMP was a gift from Mark Howarth (Addgene plasmid # 112632 ; ; RRID:Addgene_112632)
  • For your References section:

    Assembling and decorating hyaluronan hydrogels with twin protein superglues to mimic cell-cell interactions. Wieduwild R, Howarth M. Biomaterials /10.1016/j.biomaterials.2018.07.020