Skip to main content

pHES 946
(Plasmid #112644)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112644 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSV603
  • Backbone size w/o insert (bp) 8370
  • Total vector size (bp) 9900
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RTG3AD-GSx7-CIB1-SV40NLS
  • Species
    S. cerevisiae (budding yeast), A. thaliana (mustard weed), Synthetic
  • Entrez Gene
    CIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
  • Promoter ADH1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGAAACAACGGTGACCGTGG
  • 3′ sequencing primer ATC GCA CTC ACG TAA ACA CTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHES 946 was a gift from Hana El-Samad (Addgene plasmid # 112644 ; http://n2t.net/addgene:112644 ; RRID:Addgene_112644)
  • For your References section:

    Real-Time Genetic Compensation Defines the Dynamic Demands of Feedback Control. Harrigan P, Madhani HD, El-Samad H. Cell. 2018 Oct 18;175(3):877-886.e10. doi: 10.1016/j.cell.2018.09.044. 10.1016/j.cell.2018.09.044 PubMed 30340045