Skip to main content
Addgene

pLenti-xBE4Gam-P2A-Puro
(Plasmid #112676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv1
  • Backbone size w/o insert (bp) 6296
  • Modifications to backbone
    SV40 NLS separates 1st UGI and (codon optimized) 2nd UGI
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    xCas9(3.7)-BE4Gam
  • Alt name
    xBE4G
  • Species
    Synthetic
  • Insert Size (bp)
    6054
  • Mutation
    D10A, A262T, R324L, S409I, E480K, E543D, M694I, E1219V
  • Promoter EF1s
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SV40 NLS separates 1st UGI and (codon optimized) 2nd UGI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-xBE4Gam-P2A-Puro was a gift from Lukas Dow (Addgene plasmid # 112676 ; http://n2t.net/addgene:112676 ; RRID:Addgene_112676)
  • For your References section:

    Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439