pcDNA4/TO-bio-myc-NES-EGFP
(Plasmid #112712)

• Purpose: For tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cells
• Depositing Lab: Daniel Schoenberg
• Publication: Trotman et al J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5078
• Total vector size (bp): 6185
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: Enhanced green fluorescence protein
• Species: Aequorea victoria
• Insert Size (bp): 1107
• Mutation: Nucleotide sequence optimized for synthetic gene production
• Promoter: CMV with Tet repressor binding sites
• Tags / Fusion Proteins:
  • biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
  • myc tag (N terminal on insert)
  • HIV Rev nuclear localization signal (NES) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: pcDNA4TO-CMV-F (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: pcDNA4TO-R (AGCATGCCTGCTATTGTCTTCCCA)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was synthesized as a gBlock by Integrated DNA Technologies
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The N-terminal tag sequence of this insert is exactly the same as in pcDNA4/TO-bio-myc-cCE, thus providing a specificity control for pulldown assays.