pcDNA3.1/TO-myc-BirA*-cCE
(Plasmid
#112713)
-
PurposeFor tetracycline-inducible expression of myc-BirA*-NES-mCE ΔNLS ("myc-BirA*-cCE") in mammalian cells. For BioID studies.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1 mycBioID
-
Backbone manufacturerAddgene plasmid #35700
- Backbone size w/o insert (bp) 6516
- Total vector size (bp) 8363
-
Modifications to backboneTet operator (TO) sequence added downstream of TATA box for Tet repressor binding at an analogous position as in pcDNA4/TO. NotI restriction site changed to a BsrGI restriction site downstream of insert.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRngtt
-
Alt nameCE, mCE
-
Alt nameCapping enzyme
-
Alt nameRNA guanylyltransferase and 5'-phosphatase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1849
-
MutationSilent mutation at Arg 132 (CGT to CGC), deleted amino acids 573-576 (KRKY nuclear localization signal)
-
Entrez GeneRngtt (a.k.a. AU020997, HCE, MCE1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc tag (N terminal on backbone)
- BirA* (BirA R118G) (N terminal on backbone)
- HIV Rev nuclear localization signal (NES) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer BGH-R (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBirA* sequence included in Addgene plasmid #35700 (credit to Kyle Roux). Source of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Tet operator sequence added to pcDNA3.1-myc-BirA*-cCE, originally described in Trotman et al. 2017 (10.1093/nar/gkx801)
Additional internal sequencing primers:
IntBirA1-F: CATTCGGAGCCAACCTGTACCTG
IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/TO-myc-BirA*-cCE was a gift from Daniel Schoenberg (Addgene plasmid # 112713 ; http://n2t.net/addgene:112713 ; RRID:Addgene_112713) -
For your References section:
RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341