Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3-bio-myc-mCE 2-210
(Plasmid #112715)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112715 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6409
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rngtt
  • Alt name
    CE, mCE
  • Alt name
    Capping enzyme
  • Alt name
    RNA guanylyltransferase and 5'-phosphatase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    969
  • Mutation
    Silent mutation at Arg 132 (CGT to CGC), deleted amino acids 211-597 (guanylyltransferase domain)
  • Entrez Gene
    Rngtt (a.k.a. AU020997, HCE, MCE1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
    • myc tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Source of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes the triphosphatase domain of RNGTT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-bio-myc-mCE 2-210 was a gift from Daniel Schoenberg (Addgene plasmid # 112715 ; http://n2t.net/addgene:112715 ; RRID:Addgene_112715)
  • For your References section:

    RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341