Skip to main content
Addgene

pcDNA3-bio-myc-mCE 211-597
(Plasmid #112716)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112716 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6949
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rngtt
  • Alt name
    CE, mCE
  • Alt name
    Capping enzyme
  • Alt name
    RNA guanylyltransferase and 5'-phosphatase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1503
  • Mutation
    deleted amino acids 2-210 (triphosphatase domain)
  • Entrez Gene
    Rngtt (a.k.a. AU020997, HCE, MCE1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
    • myc tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Source of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid encodes the guanylyltransferase domain of RNGTT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-bio-myc-mCE 211-597 was a gift from Daniel Schoenberg (Addgene plasmid # 112716 ; http://n2t.net/addgene:112716 ; RRID:Addgene_112716)
  • For your References section:

    RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341