pGMV-gSWEET4
(Plasmid
#112796)
-
PurposeUniversal BeYDV-derived vector with gRNAs targeting the VviSWEET4 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGMV-U
-
Backbone manufacturern/a
- Total vector size (bp) 14985
-
Vector typePlant Expression, CRISPR
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA pair targeting VviSWEET4
-
gRNA/shRNA sequenceVviSWEET4
-
SpeciesVitis vinifera
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TCAAAAGTCCCACATCGCTTAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results identified an IS1 element immediately upstream of KanR, which should not affect plasmid function.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMV-gSWEET4 was a gift from Humberto Prieto (Addgene plasmid # 112796 ; http://n2t.net/addgene:112796 ; RRID:Addgene_112796) -
For your References section:
Grape Biotechnology: Past, Present, and Future. Prieto H, Miccono M, Aguirre C, Sánchez E, Castro A. In: Cantu D., Walker M. (eds) The Grape Genome. Compendium of Plant Genomes. Springer, Cham. 10.1007/978-3-030-18601-2_16.
Map uploaded by the depositor.
