rat APOBEC1 E63A
(Plasmid
#112861)
-
Purposeplasmid for expression of a catalytically inactive rat APOBEC1 mutant in mammalian cells
-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4727
- Total vector size (bp) 4627
-
Modifications to backbonethe EGFP cds has been removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPOBEC1
-
Alt nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)684
-
Mutationchanged Glutamic acid 63 to Alanine
-
GenBank IDNM_012907
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
- Promoter CMV promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (unknown if destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rat APOBEC1 E63A was a gift from Silvestro Conticello (Addgene plasmid # 112861 ; http://n2t.net/addgene:112861 ; RRID:Addgene_112861) -
For your References section:
Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803