-
PurposeBaculovirus-mediated rAAV production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-6 cap gene in Sf9 insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac-Dual
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 9335
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemodified AAV-2 rep78
-
Insert Size (bp)1866
- Promoter polyhedrin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemodified AAV-6 cap
-
Insert Size (bp)2211
- Promoter P10
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ACGGACCTTTAATTCAACCCA
- 3′ sequencing primer CTTCCGTGTTTCAGTTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Rep78 ORF utilizes a non-canonical initiation codon (CTG codon) beginning at nt 6822.
VP1 capsid ORF utilizes a non-canonical initiation codon (TTG codon) beginning at nt 6514.
Additional article references: Barbash et al. Gene Therapy 20: 274-282 (2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR646 was a gift from Robert Kotin (Addgene plasmid # 65215 ; http://n2t.net/addgene:65215 ; RRID:Addgene_65215) -
For your References section:
A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Smith RH, Levy JR, Kotin RM. Mol Ther. 2009 Nov;17(11):1888-96. doi: 10.1038/mt.2009.128. Epub 2009 Jun 16. 10.1038/mt.2009.128 PubMed 19532142