This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJY-RpABE-FT_INF
(Plasmid #112874)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112874 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    RPS5A promoter
  • gRNA/shRNA sequence
    ggagatattctcggaggtga
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1664

Gene/Insert 2

  • Gene/Insert name
    ABE7.10
  • gRNA/shRNA sequence
    ggagatattctcggaggtga
  • Species
    engineered
  • Insert Size (bp)
    5328

Gene/Insert 3

  • Gene/Insert name
    U6-sgRNA targeting FT
  • gRNA/shRNA sequence
    ggagatattctcggaggtga
  • Insert Size (bp)
    548

Resource Information

Depositor Comments

Induces Y85H at FT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJY-RpABE-FT_INF was a gift from Jin-Soo Kim & Jae-Young Yun (Addgene plasmid # 112874 ; http://n2t.net/addgene:112874 ; RRID:Addgene_112874)
  • For your References section:

    Precision genome engineering through adenine base editing in plants. Kang BC, Yun JY, Kim ST, Shin Y, Ryu J, Choi M, Woo JW, Kim JS. Nat Plants. 2018 Jun 4. pii: 10.1038/s41477-018-0178-x. doi: 10.1038/s41477-018-0178-x. 10.1038/s41477-018-0178-x [pii] PubMed 29867128