Skip to main content

pAW207
(Plasmid #113247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 4382
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    IHFa K20A
  • Species
    E. coli
  • Insert Size (bp)
    297
  • Mutation
    K20A
  • Entrez Gene
    ihfA (a.k.a. b1712, ECK1710, hid, himA)
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGATCTCGACGCTCTCCCT
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    IHFb
  • Species
    E. coli
  • Insert Size (bp)
    282
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW207 was a gift from Jennifer Doudna (Addgene plasmid # 113247 ; http://n2t.net/addgene:113247 ; RRID:Addgene_113247)
  • For your References section:

    Structures of the CRISPR genome integration complex. Wright AV, Liu JJ, Knott GJ, Doxzen KW, Nogales E, Doudna JA. Science. 2017 Sep 15;357(6356):1113-1118. doi: 10.1126/science.aao0679. Epub 2017 Jul 20. 10.1126/science.aao0679 PubMed 28729350