pAW-AlphaLobe
(Plasmid
#113255)
-
PurposeE. coli expression vector for His-MBP-Cas9 Alpha-Helical Lobe
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone2CT
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7949
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes Cas9 alpha-helical lobe
-
SpeciesS. pyogenes
-
Insert Size (bp)2091
-
Mutationresidues 56–714; See paper for description
-
GenBank IDNC_002737.2
- Promoter T7
-
Tag
/ Fusion Protein
- 10xHis-MBP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCGGTCGTCAGACTGTCG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySam Sternberg, Doudna lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW-AlphaLobe was a gift from Jennifer Doudna (Addgene plasmid # 113255 ; http://n2t.net/addgene:113255 ; RRID:Addgene_113255) -
For your References section:
Rational design of a split-Cas9 enzyme complex. Wright AV, Sternberg SH, Taylor DW, Staahl BT, Bardales JA, Kornfeld JE, Doudna JA. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):2984-9. doi: 10.1073/pnas.1501698112. Epub 2015 Feb 23. 10.1073/pnas.1501698112 PubMed 25713377