Skip to main content

pAW-AlphaLobe
(Plasmid #113255)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113255 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    2CT
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7949
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes Cas9 alpha-helical lobe
  • Species
    S. pyogenes
  • Insert Size (bp)
    2091
  • Mutation
    residues 56–714; See paper for description
  • GenBank ID
    NC_002737.2
  • Promoter T7
  • Tag / Fusion Protein
    • 10xHis-MBP (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCGGTCGTCAGACTGTCG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW-AlphaLobe was a gift from Jennifer Doudna (Addgene plasmid # 113255 ; http://n2t.net/addgene:113255 ; RRID:Addgene_113255)
  • For your References section:

    Rational design of a split-Cas9 enzyme complex. Wright AV, Sternberg SH, Taylor DW, Staahl BT, Bardales JA, Kornfeld JE, Doudna JA. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):2984-9. doi: 10.1073/pnas.1501698112. Epub 2015 Feb 23. 10.1073/pnas.1501698112 PubMed 25713377