Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJF104B
(Plasmid #113324)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113324 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dCas9 and MCP-SoxS_R93A
  • Mutation
    R93A

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACGCATTGATTTGAGTCAGC
  • 3′ sequencing primer tcgtaagccatttccgctcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJF104B was a gift from Jesse Zalatan (Addgene plasmid # 113324 ; http://n2t.net/addgene:113324 ; RRID:Addgene_113324)
  • For your References section:

    Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria. Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG. Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6. 10.1038/s41467-018-04901-6 PubMed 29950558