pSUPER.retro.puro-shMePCE
(Plasmid
#113536)
-
PurposeRetroviral vector designed to knock down MePCE.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSUPER.retro.puro
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 6349
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshMePCE
-
gRNA/shRNA sequenceAAGCCAGAGCAGTTCAGTTCCT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)22
-
Entrez GeneMEPCE (a.k.a. BCDIN3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (destroyed during cloning)
- 3′ cloning site Hind III (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPER.retro.puro-shMePCE was a gift from Blerta Xhemalce (Addgene plasmid # 113536 ; http://n2t.net/addgene:113536 ; RRID:Addgene_113536) -
For your References section:
Crosstalk between the RNA Methylation and Histone-Binding Activities of MePCE Regulates P-TEFb Activation on Chromatin. Shelton SB, Shah NM, Abell NS, Devanathan SK, Mercado M, Xhemalce B. Cell Rep. 2018 Feb 6;22(6):1374-1383. doi: 10.1016/j.celrep.2018.01.028. 10.1016/j.celrep.2018.01.028 PubMed 29425494