pCS2(+)-mVenus-cdt1(aa1-147)
(Plasmid
#113615)
-
PurposeLive cell cycle biosensor made for the segmented worm Platynereis dumerilii. The biosensor allows observing cell cycle dynamics in live embryos.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 5289
-
Vector typeExpression vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTypically grows fine with commercial general cloning bacteria strains
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePdu-cdt1
-
Alt namecdt1
-
SpeciesPlatynereis dumerilii
-
Insert Size (bp)441
-
Mutationtruncated sequence - amino acids 1-147 used for the insert. Total insert size for mVenus-cdt1(aa1-147) is 1179 bp
-
GenBank IDMF614951.1 MF614950.1
-
Tag
/ Fusion Protein
- mVenus (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAGAACTATAGTGTGTTGTATTACGT
- 3′ sequencing primer AGAGGCCTTGAATTCGAATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The mVenus-cdt1 fusion contains a R339S change that is not of functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2(+)-mVenus-cdt1(aa1-147) was a gift from Guillaume Balavoine & Duygu Ozpolat (Addgene plasmid # 113615) -
For your References section:
Cell lineage and cell cycling analyses of the 4d micromere using live imaging in the marine annelid Platynereis dumerilii. Ozpolat BD, Handberg-Thorsager M, Vervoort M, Balavoine G. Elife. 2017 Dec 12;6. pii: 30463. doi: 10.7554/eLife.30463. 30463 [pii] PubMed 29231816