Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS2(+)-mVenus-cdt1(aa1-147)
(Plasmid #113615)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113615 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 5289
  • Vector type
    Expression vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Typically grows fine with commercial general cloning bacteria strains
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pdu-cdt1
  • Alt name
    cdt1
  • Species
    Platynereis dumerilii
  • Insert Size (bp)
    441
  • Mutation
    truncated sequence - amino acids 1-147 used for the insert. Total insert size for mVenus-cdt1(aa1-147) is 1179 bp
  • GenBank ID
    MF614951.1 MF614950.1
  • Tag / Fusion Protein
    • mVenus (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTAGAACTATAGTGTGTTGTATTACGT
  • 3′ sequencing primer AGAGGCCTTGAATTCGAATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mVenus-cdt1 fusion contains a R339S change that is not of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2(+)-mVenus-cdt1(aa1-147) was a gift from Guillaume Balavoine & Duygu Ozpolat (Addgene plasmid # 113615)
  • For your References section:

    Cell lineage and cell cycling analyses of the 4d micromere using live imaging in the marine annelid Platynereis dumerilii. Ozpolat BD, Handberg-Thorsager M, Vervoort M, Balavoine G. Elife. 2017 Dec 12;6. pii: 30463. doi: 10.7554/eLife.30463. 30463 [pii] PubMed 29231816