-
PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reporters
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name7a sgRNA
-
gRNA/shRNA sequencegaccaccctgacctacggcta
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
7a sgRNA for EJ7-GFP and 4-μHOM reporters was a gift from Jeremy Stark (Addgene plasmid # 113620 ; http://n2t.net/addgene:113620 ; RRID:Addgene_113620) -
For your References section:
C-NHEJ without indels is robust and requires synergistic function of distinct XLF domains. Bhargava R, Sandhu M, Muk S, Lee G, Vaidehi N, Stark JM. Nat Commun. 2018 Jun 27;9(1):2484. doi: 10.1038/s41467-018-04867-5. 10.1038/s41467-018-04867-5 [pii] PubMed 29950655