pR I-Ab beta Derp1-117
(Plasmid
#113639)
-
PurposeInsect cell expression vector for I-Ab beta chain fused to Der p 1 117-127 antigenic peptide
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRMHa-3
- Backbone size w/o insert (bp) 3818
- Total vector size (bp) 4712
-
Modifications to backbonepoint mutation at 1706 to ablate second SpeI restriction site
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameI-Ab beta Derp1-117
-
Alt nameH-2 I-Ab beta
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)882
-
Mutationtransmembrane and cytoplasmic domains truncated
-
Entrez GeneH2-Ab1 (a.k.a. AI845868, Abe, Abeta, H-2A, H-2Ab, H2-A, H2-Ab, H2-Ab_, I, I-A<, I-Ab, I-Abeta, IAb, Ia, Ia-2, Ia2, Rmc, Rmcs1)
- Promoter Metallothionein
-
Tags
/ Fusion Proteins
- fused to Der p 1 (117-127) peptide via Gly-Ser linker (inserted downstream of signal peptide) (N terminal on insert)
- fused to Fos-Jun basic leucine zipper motif via Gly-Ser linker (C terminal on insert)
- 6x His tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TGTGCAAAAGAGGTGAATCG
- 3′ sequencing primer CTGCCGCTCCCATTTATCTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct, when co-expressed with the corresponding alpha chain construct in Drosophila S2 cells and induced with copper sulfate, results in secreted expression of soluble peptide:MHCII complexes. The antigenic peptide sequence (residues 117-127 of Der p 1 allergen) is encoded as a fusion to the N-terminus of I-Ab beta, connected via a Gly-Ser linker. This fusion is encoded just downstream of the signal peptide, which should be cleaved during post-translational processing. Alternative antigenic peptides can be cloned in place of Der p 1 117-127 by exploiting the XmaI and SpeI restriction sites flanking this sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR I-Ab beta Derp1-117 was a gift from James Moon (Addgene plasmid # 113639 ; http://n2t.net/addgene:113639 ; RRID:Addgene_113639) -
For your References section:
Generation of Allergen-Specific Tetramers for a Murine Model of Airway Inflammation. Moon JJ, Pepper M. Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14. 10.1007/978-1-4939-7896-0_14 PubMed 29956152