Skip to main content

pR BirA
(Plasmid #113640)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113640 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRMHa-3
  • Backbone size w/o insert (bp) 3830
  • Total vector size (bp) 4802
  • Modifications to backbone
    point mutation at 1796 to ablate second SpeI restriction site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BirA Biotin Ligase
  • Insert Size (bp)
    972
  • Entrez Gene
    birA (a.k.a. b3973, ECK3965, bioR, dhbB)
  • Promoter Metallothionein

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TGTGCAAAAGAGGTGAATCG
  • 3′ sequencing primer CTGCCGCTCCCATTTATCTAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    William Kwok, Benaroya Research Institute, Seattle, WA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This gene encodes a biotin ligase that mediates in vivo biotinylation of BirA signal sequences on recombinant proteins co-expressed in the same cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR BirA was a gift from James Moon (Addgene plasmid # 113640 ; http://n2t.net/addgene:113640 ; RRID:Addgene_113640)
  • For your References section:

    Generation of Allergen-Specific Tetramers for a Murine Model of Airway Inflammation. Moon JJ, Pepper M. Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14. 10.1007/978-1-4939-7896-0_14 PubMed 29956152