-
PurposeInsect cell expression vector for BirA Biotin Ligase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRMHa-3
- Backbone size w/o insert (bp) 3830
- Total vector size (bp) 4802
-
Modifications to backbonepoint mutation at 1796 to ablate second SpeI restriction site
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBirA Biotin Ligase
-
Insert Size (bp)972
-
Entrez GenebirA (a.k.a. b3973, ECK3965, bioR, dhbB)
- Promoter Metallothionein
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TGTGCAAAAGAGGTGAATCG
- 3′ sequencing primer CTGCCGCTCCCATTTATCTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWilliam Kwok, Benaroya Research Institute, Seattle, WA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This gene encodes a biotin ligase that mediates in vivo biotinylation of BirA signal sequences on recombinant proteins co-expressed in the same cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR BirA was a gift from James Moon (Addgene plasmid # 113640 ; http://n2t.net/addgene:113640 ; RRID:Addgene_113640) -
For your References section:
Generation of Allergen-Specific Tetramers for a Murine Model of Airway Inflammation. Moon JJ, Pepper M. Methods Mol Biol. 2018;1799:165-181. doi: 10.1007/978-1-4939-7896-0_14. 10.1007/978-1-4939-7896-0_14 PubMed 29956152