Skip to main content

pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
(Plasmid #113699)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113699 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV
  • Backbone manufacturer
    Alligent Technologies
  • Total vector size (bp) 6292
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SaCas9 gRNA Cassete
  • gRNA/shRNA sequence
    GGCCTCCCCAAAGCCTGGCCA
  • Species
    Synthetic
  • Insert Size (bp)
    76

Gene/Insert 2

  • Gene/Insert name
    GFP
  • gRNA/shRNA sequence
    N/A
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591. pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA from Jonathan Ploski, plasmid #82706.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The U6TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA was a gift from Jonathan Ploski (Addgene plasmid # 113699 ; http://n2t.net/addgene:113699 ; RRID:Addgene_113699)
  • For your References section:

    The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, de Solis C, Aradhana, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU, Ploski JE. Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018. 10.3389/fnmol.2018.00413 PubMed 30483052