pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
(Plasmid
#113699)
-
PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAlligent Technologies
- Total vector size (bp) 6292
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSaCas9 gRNA Cassete
-
gRNA/shRNA sequenceGGCCTCCCCAAAGCCTGGCCA
-
SpeciesSynthetic
-
Insert Size (bp)76
Gene/Insert 2
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceN/A
-
SpeciesSynthetic
-
Insert Size (bp)717
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591. pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA from Jonathan Ploski, plasmid #82706.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The U6TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA was a gift from Jonathan Ploski (Addgene plasmid # 113699 ; http://n2t.net/addgene:113699 ; RRID:Addgene_113699) -
For your References section:
The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, de Solis C, Aradhana, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU, Ploski JE. Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018. 10.3389/fnmol.2018.00413 PubMed 30483052