Skip to main content

pCDF1-MCS2-EF1-Puro-RGS7-R44C
(Plasmid #113729)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113729 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PCDF1
  • Backbone size w/o insert (bp) 6583
  • Total vector size (bp) 8014
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RGS7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1407
  • Entrez Gene
    RGS7
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atggcccaggggaataattat
  • 3′ sequencing primer ttacttatcgtcgtcatccttgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF1-MCS2-EF1-Puro-RGS7-R44C was a gift from Yardena Samuels (Addgene plasmid # 113729 ; http://n2t.net/addgene:113729 ; RRID:Addgene_113729)
  • For your References section:

    RGS7 is recurrently mutated in melanoma and promotes migration and invasion of human cancer cells. Qutob N, Masuho I, Alon M, Emmanuel R, Cohen I, Di Pizio A, Madore J, Elkahloun A, Ziv T, Levy R, Gartner JJ, Hill VK, Lin JC, Hevroni Y, Greenberg P, Brodezki A, Rosenberg SA, Kosloff M, Hayward NK, Admon A, Niv MY, Scolyer RA, Martemyanov KA, Samuels Y. Sci Rep. 2018 Jan 12;8(1):653. doi: 10.1038/s41598-017-18851-4. 10.1038/s41598-017-18851-4 [pii] PubMed 29330521