Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR-PpU6P-sgRNA-R4R3
(Plasmid #113739)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113739 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR221-P4rP3r
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2664
  • Vector type
    CRISPR ; Gateway Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PpU6P::sgRNA
  • gRNA/shRNA sequence
    aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctat
  • Insert Size (bp)
    461
  • Promoter P. patens U6 promoter

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-PpU6P-sgRNA-R4R3 was a gift from Magdalena Bezanilla (Addgene plasmid # 113739 ; http://n2t.net/addgene:113739 ; RRID:Addgene_113739)
  • For your References section:

    Efficient and modular CRISPR-Cas9 vector system for Physcomitrella patens. Mallett DR, Chang M, Cheng X, Bezanilla M. Plant Direct. 2019 Sep 12;3(9):e00168. doi: 10.1002/pld3.168. eCollection 2019 Sep. 10.1002/pld3.168 PubMed 31523744