pVP91A-pcaHG
(Plasmid #113766)

• Purpose: Expresses the alpha (pcaG) and the beta (pcaH) subunits of Protocatechuate 3,4-Dioxygenase from Pseudomonas putida.
• Depositing Lab: John Lipscomb
• Publication: Knoot et al Proc Natl Acad Sci U S A. 2015 Jan 13;112(2):388-93. doi: 10.1073/pnas.1419118112. Epub 2014 Dec 29.

Backbone

• Vector backbone: pVP91A vector
• Backbone manufacturer: DNASU plasmid repository, Arizona State University Biodesign Institute
• Backbone size w/o insert (bp): 4010
• Total vector size (bp): 5382
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use E. coli Bl21 for protein expression
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: β subunit of Protocatechuate 3,4- Dioxygenase
• Species: P. putida
• Insert Size (bp): 720
• Promoter: T5 promoter
• Tag / Fusion Protein:
  • Met-6xHis (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CACACAGAATTCATTAAAGAGG
• 3′ sequencing primer: GTCGACTCTAGAGGATCC

Gene/Insert 2

• Gene/Insert name: α subunit of Protocatechuate 3,4- Dioxygenase
• Species: P. putida
• Insert Size (bp): 606
• Promoter: T5 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CACACAGAATTCATTAAAGAGG
• 3′ sequencing primer: GTCGACTCTAGAGGATCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: John D. Lipscomb, Department of Biochemistry Molecular Biology and Biophysics and Center for Metals in Biocatalysis, University of Minnesota, Minneapolis, MN 55455 .
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please ensure that the chosen expression cell line expresses the T5 RNA polymerase.

Senavirathne, G., et al., Expression and purification of nuclease-free protocatechuate 3,4-dioxygenase for prolonged single-molecule fluorescence imaging. Anal Biochem, 2018. 556: p. 78-84.