-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEYFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegolgi associated, gamma adaptin ear containing, ARF binding protein 1
-
Alt nameGGA1
-
Alt nameNGAT
-
Alt namehook
-
SpeciesH. sapiens (human)
-
Insert Size (bp)141
-
GenBank IDNM_013365
-
Entrez GeneGGA1
-
Tag
/ Fusion Protein
- YFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTGAGCAAAGACCCCAACGAGAA
- 3′ sequencing primer CAGGGGGAGGTGTGGGAGGTTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhGGA1 cDNA was a gift of Juan Bonifacino. The N-terminal end of the GAT domain, corresponding to amino acids 165-210 and termed NGAT, were amplified and inserted in pEYFP-C1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Encodes a YFP fusion to the N-terminus of the GGA1 NGAT domain. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP variant.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYFP-NGAT was a gift from Joel Swanson (Addgene plasmid # 11383 ; http://n2t.net/addgene:11383 ; RRID:Addgene_11383) -
For your References section:
A Phosphatidylinositol-3-Kinase-Dependent Signal Transition Regulates ARF1 and ARF6 during Fcgamma Receptor-Mediated Phagocytosis. Beemiller P, Hoppe AD, Swanson JA. PLoS Biol. 2006 May 9. 4(6):e162. 10.1371/journal.pbio.0040162 PubMed 16669702