Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

YFP-Rac2(V12)
(Plasmid #11397)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEYFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ras-related C3 botulinum toxin substrate 2
  • Alt name
    Rac2(V12)
  • Alt name
    YFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    579
  • Mutation
    Obtained with Glycine 12 changed to Valine.
  • GenBank ID
    AF498965
  • Entrez Gene
    RAC2 (a.k.a. EN-7, Gx, HSPC022, IMD73A, IMD73B, IMD73C, p21-Rac2)
  • Tag / Fusion Protein
    • YFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCTGAGCAAAGACCCCAACGAGAA
  • 3′ sequencing primer CAGGGGGAGGTGTGGGAGGTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Human Rac2(G12V) cDNA was obtained from the UMR cDNA Resource Center (www.cdna.org).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expresses Rac2(V12) with an N-terminal YFP marker. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YFP-Rac2(V12) was a gift from Joel Swanson (Addgene plasmid # 11397 ; http://n2t.net/addgene:11397 ; RRID:Addgene_11397)
  • For your References section:

    Cdc42, Rac1, and Rac2 display distinct patterns of activation during phagocytosis. Hoppe AD, Swanson JA. Mol Biol Cell 2004 Aug;15(8):3509-19. Epub 2004 May 28. 10.1091/mbc.e03-11-0847 PubMed 15169870