pCDF1-WT_RASA2-EF1-Puro
(Plasmid
#114096)
-
PurposeExpress RASA2 in mamalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCDF1
- Backbone size w/o insert (bp) 6606
- Total vector size (bp) 9153
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRASA2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2547
-
Entrez GeneRASA2 (a.k.a. GAP1M)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCGGCGGCGGCGCCTGCTGCTG
- 3′ sequencing primer CTAAGATGCTTTCCCAACAATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF1-WT_RASA2-EF1-Puro was a gift from Yardena Samuels (Addgene plasmid # 114096 ; http://n2t.net/addgene:114096 ; RRID:Addgene_114096) -
For your References section:
Recurrent inactivating RASA2 mutations in melanoma. Arafeh R, Qutob N, Emmanuel R, Keren-Paz A, Madore J, Elkahloun A, Wilmott JS, Gartner JJ, Di Pizio A, Winograd-Katz S, Sindiri S, Rotkopf R, Dutton-Regester K, Johansson P, Pritchard AL, Waddell N, Hill VK, Lin JC, Hevroni Y, Rosenberg SA, Khan J, Ben-Dor S, Niv MY, Ulitsky I, Mann GJ, Scolyer RA, Hayward NK, Samuels Y. Nat Genet. 2015 Dec;47(12):1408-10. doi: 10.1038/ng.3427. Epub 2015 Oct 26. 10.1038/ng.3427 PubMed 26502337